[6922 Search Results


93
ATCC substitution b domain c nai003 ge2270a compound 2 atcc
Synthetic route to <t>NAI003.</t> DPPA, diphenyl phosphorazidate.
Substitution B Domain C Nai003 Ge2270a Compound 2 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/substitution b domain c nai003 ge2270a compound 2 atcc/product/ATCC
Average 93 stars, based on 1 article reviews
substitution b domain c nai003 ge2270a compound 2 atcc - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
ATCC escherichia coli
Synthetic route to <t>NAI003.</t> DPPA, diphenyl phosphorazidate.
Escherichia Coli, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/escherichia coli/product/ATCC
Average 93 stars, based on 1 article reviews
escherichia coli - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc anti aconitase 2
Synthetic route to <t>NAI003.</t> DPPA, diphenyl phosphorazidate.
Anti Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti aconitase 2/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
anti aconitase 2 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

91
DSMZ corynebacterium amycolatum
Antimicrobial activity of purified corynaridin against pathogenic corynebacteria. The RPC fraction was used undiluted and in a dilution series against (a) C. glutamicum ATCC 13032, (b) C. striatum DSM 20668, and (c) C. <t>amycolatum</t> DSM 6922. For each spot, a 10-μL sample was used (RPC fraction with 606 μg/mL total protein). A nisin standard (250 μg/mL) and HPLC-grade H 2 O (control) were used as positive and negative controls, respectively.
Corynebacterium Amycolatum, supplied by DSMZ, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/corynebacterium amycolatum/product/DSMZ
Average 91 stars, based on 1 article reviews
corynebacterium amycolatum - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

90
Goldschmidt Chemical Corp tegopren® 5842
Antimicrobial activity of purified corynaridin against pathogenic corynebacteria. The RPC fraction was used undiluted and in a dilution series against (a) C. glutamicum ATCC 13032, (b) C. striatum DSM 20668, and (c) C. <t>amycolatum</t> DSM 6922. For each spot, a 10-μL sample was used (RPC fraction with 606 μg/mL total protein). A nisin standard (250 μg/mL) and HPLC-grade H 2 O (control) were used as positive and negative controls, respectively.
Tegopren® 5842, supplied by Goldschmidt Chemical Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tegopren® 5842/product/Goldschmidt Chemical Corp
Average 90 stars, based on 1 article reviews
tegopren® 5842 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Philips Healthcare vacuum tube philips 6922
Antimicrobial activity of purified corynaridin against pathogenic corynebacteria. The RPC fraction was used undiluted and in a dilution series against (a) C. glutamicum ATCC 13032, (b) C. striatum DSM 20668, and (c) C. <t>amycolatum</t> DSM 6922. For each spot, a 10-μL sample was used (RPC fraction with 606 μg/mL total protein). A nisin standard (250 μg/mL) and HPLC-grade H 2 O (control) were used as positive and negative controls, respectively.
Vacuum Tube Philips 6922, supplied by Philips Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vacuum tube philips 6922/product/Philips Healthcare
Average 90 stars, based on 1 article reviews
vacuum tube philips 6922 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Quikrete Companies quik-tube part number 6922
Antimicrobial activity of purified corynaridin against pathogenic corynebacteria. The RPC fraction was used undiluted and in a dilution series against (a) C. glutamicum ATCC 13032, (b) C. striatum DSM 20668, and (c) C. <t>amycolatum</t> DSM 6922. For each spot, a 10-μL sample was used (RPC fraction with 606 μg/mL total protein). A nisin standard (250 μg/mL) and HPLC-grade H 2 O (control) were used as positive and negative controls, respectively.
Quik Tube Part Number 6922, supplied by Quikrete Companies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/quik-tube part number 6922/product/Quikrete Companies
Average 90 stars, based on 1 article reviews
quik-tube part number 6922 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
DeGussa Corporation tegopren 6922
Antimicrobial activity of purified corynaridin against pathogenic corynebacteria. The RPC fraction was used undiluted and in a dilution series against (a) C. glutamicum ATCC 13032, (b) C. striatum DSM 20668, and (c) C. <t>amycolatum</t> DSM 6922. For each spot, a 10-μL sample was used (RPC fraction with 606 μg/mL total protein). A nisin standard (250 μg/mL) and HPLC-grade H 2 O (control) were used as positive and negative controls, respectively.
Tegopren 6922, supplied by DeGussa Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tegopren 6922/product/DeGussa Corporation
Average 90 stars, based on 1 article reviews
tegopren 6922 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

N/A
strong MicroRNA mmu miR 6922 3p strong Accession Number MIMAT0027745 Mature Sequence UGUUCUGCUCACCCUUCUCACAG mmu miR 6922 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
  Buy from Supplier

N/A
Hairpin precursor miRNA of approximately 150 nucleotides is cloned into lentiviral or non-viral vectors for delivery in virtually all cell types.
  Buy from Supplier

N/A
strong MicroRNA mmu miR 6922 5p strong Accession Number MIMAT0027744 Mature Sequence UGUGGGAGGGGACUGUAGAGAGG mmu miR 6922 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
  Buy from Supplier

Image Search Results


Synthetic route to NAI003. DPPA, diphenyl phosphorazidate.

Journal: Antimicrobial Agents and Chemotherapy

Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes

doi: 10.1128/AAC.05155-14

Figure Lengend Snippet: Synthetic route to NAI003. DPPA, diphenyl phosphorazidate.

Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic: Substitution b Domain c NAI003 GE2270A Compound 2 ATCC 6922 0.015 0.007 ≤0.06 L1015R13 C207A H68Q I 8 0.015 0.5 L1015R51 T245C V81A I 32 ≤0.06 1 L1015R6 G300T Q99H I 8 0.015 1 L1015R5 G300T Q99H I 2 0.007 0.5 L1015R7 G300T Q99H I 1 0.003 0.25 L1015R24 G781C G260R II >128 0.125 0.25 L1015R8 G781T G260C II 32 0.125 2 L1015R96 T791C M263T II 4 ≤0.06 4 L1015R73 A830G N276S II 1 0.007 0.125 L1015R72 A830G N276S II 2 0.007 0.25 L1015R21 C831G N276K II 1 0.03 0.25 L1015R86 None None 128 0.25 4 Open in a separate window a Nucleotide numbering is based on tuf sequence from P. acnes KPA171202 ( 15 ). b Amino acid numbering is based on EF-Tu sequence from P. acnes KPA171202 ( 15 ). c As defined by Parmeggiani et al. ( 11 ).

Techniques:

MICs of  GE2270A,   compound 2,  and  NAI003  against selected Gram-positive bacteria

Journal: Antimicrobial Agents and Chemotherapy

Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes

doi: 10.1128/AAC.05155-14

Figure Lengend Snippet: MICs of GE2270A, compound 2, and NAI003 against selected Gram-positive bacteria

Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic: Substitution b Domain c NAI003 GE2270A Compound 2 ATCC 6922 0.015 0.007 ≤0.06 L1015R13 C207A H68Q I 8 0.015 0.5 L1015R51 T245C V81A I 32 ≤0.06 1 L1015R6 G300T Q99H I 8 0.015 1 L1015R5 G300T Q99H I 2 0.007 0.5 L1015R7 G300T Q99H I 1 0.003 0.25 L1015R24 G781C G260R II >128 0.125 0.25 L1015R8 G781T G260C II 32 0.125 2 L1015R96 T791C M263T II 4 ≤0.06 4 L1015R73 A830G N276S II 1 0.007 0.125 L1015R72 A830G N276S II 2 0.007 0.25 L1015R21 C831G N276K II 1 0.03 0.25 L1015R86 None None 128 0.25 4 Open in a separate window a Nucleotide numbering is based on tuf sequence from P. acnes KPA171202 ( 15 ). b Amino acid numbering is based on EF-Tu sequence from P. acnes KPA171202 ( 15 ). c As defined by Parmeggiani et al. ( 11 ).

Techniques:

MICs of  GE2270A,   compound 2,  and  NAI003  against P. acnes

Journal: Antimicrobial Agents and Chemotherapy

Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes

doi: 10.1128/AAC.05155-14

Figure Lengend Snippet: MICs of GE2270A, compound 2, and NAI003 against P. acnes

Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic: Substitution b Domain c NAI003 GE2270A Compound 2 ATCC 6922 0.015 0.007 ≤0.06 L1015R13 C207A H68Q I 8 0.015 0.5 L1015R51 T245C V81A I 32 ≤0.06 1 L1015R6 G300T Q99H I 8 0.015 1 L1015R5 G300T Q99H I 2 0.007 0.5 L1015R7 G300T Q99H I 1 0.003 0.25 L1015R24 G781C G260R II >128 0.125 0.25 L1015R8 G781T G260C II 32 0.125 2 L1015R96 T791C M263T II 4 ≤0.06 4 L1015R73 A830G N276S II 1 0.007 0.125 L1015R72 A830G N276S II 2 0.007 0.25 L1015R21 C831G N276K II 1 0.03 0.25 L1015R86 None None 128 0.25 4 Open in a separate window a Nucleotide numbering is based on tuf sequence from P. acnes KPA171202 ( 15 ). b Amino acid numbering is based on EF-Tu sequence from P. acnes KPA171202 ( 15 ). c As defined by Parmeggiani et al. ( 11 ).

Techniques:

Killing kinetics of P. acnes. Effect of NAI003 (closed symbols, solid lines) and clindamycin (empty symbols, dashed lines) on the viability of P. acnes, using the clindamycin-sensitive ND062711 (A) and clindamycin-resistant ND06311 (B) isolates. Compounds were added at 1× MIC (triangles), 10× MIC (circles), or 100× MIC (squares). In panel B, clindamycin was used at only 1× (open triangles) and 4× (open diamonds) the MIC. Growth controls are shown for both panels by a thick dashed line.

Journal: Antimicrobial Agents and Chemotherapy

Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes

doi: 10.1128/AAC.05155-14

Figure Lengend Snippet: Killing kinetics of P. acnes. Effect of NAI003 (closed symbols, solid lines) and clindamycin (empty symbols, dashed lines) on the viability of P. acnes, using the clindamycin-sensitive ND062711 (A) and clindamycin-resistant ND06311 (B) isolates. Compounds were added at 1× MIC (triangles), 10× MIC (circles), or 100× MIC (squares). In panel B, clindamycin was used at only 1× (open triangles) and 4× (open diamonds) the MIC. Growth controls are shown for both panels by a thick dashed line.

Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic: Substitution b Domain c NAI003 GE2270A Compound 2 ATCC 6922 0.015 0.007 ≤0.06 L1015R13 C207A H68Q I 8 0.015 0.5 L1015R51 T245C V81A I 32 ≤0.06 1 L1015R6 G300T Q99H I 8 0.015 1 L1015R5 G300T Q99H I 2 0.007 0.5 L1015R7 G300T Q99H I 1 0.003 0.25 L1015R24 G781C G260R II >128 0.125 0.25 L1015R8 G781T G260C II 32 0.125 2 L1015R96 T791C M263T II 4 ≤0.06 4 L1015R73 A830G N276S II 1 0.007 0.125 L1015R72 A830G N276S II 2 0.007 0.25 L1015R21 C831G N276K II 1 0.03 0.25 L1015R86 None None 128 0.25 4 Open in a separate window a Nucleotide numbering is based on tuf sequence from P. acnes KPA171202 ( 15 ). b Amino acid numbering is based on EF-Tu sequence from P. acnes KPA171202 ( 15 ). c As defined by Parmeggiani et al. ( 11 ).

Techniques:

Effects of GE2270A and NAI003 on the electrophoretic mobility of EF-Tu and on in vitro translation. (A) Migration on native polyacrylamide gel of E. coli EF-Tu (preincubated with GTP) in the presence of increasing concentrations (from left to right, 0.1, 0.5, 1, 5, 10, 50, and 100 μM) of GE2270A (lanes 2 to 8) or NAI003 (lanes 9 to 15). (B) Electrophoretic mobility difference between EF-Tu–GTP alone (lane 1) and in the presence of 1 μM GE2270A (lane 2) or of 10 μM NAI003 (lane 3). The two arrows indicate the different migrations of EF-Tu in complex with GE2270A or with NAI003. (C) Inhibition by GE2270A (●) or NAI003 (■) in a protein synthesis system based on an E. coli extract programmed with 027-IF2Cp(A) mRNA.

Journal: Antimicrobial Agents and Chemotherapy

Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes

doi: 10.1128/AAC.05155-14

Figure Lengend Snippet: Effects of GE2270A and NAI003 on the electrophoretic mobility of EF-Tu and on in vitro translation. (A) Migration on native polyacrylamide gel of E. coli EF-Tu (preincubated with GTP) in the presence of increasing concentrations (from left to right, 0.1, 0.5, 1, 5, 10, 50, and 100 μM) of GE2270A (lanes 2 to 8) or NAI003 (lanes 9 to 15). (B) Electrophoretic mobility difference between EF-Tu–GTP alone (lane 1) and in the presence of 1 μM GE2270A (lane 2) or of 10 μM NAI003 (lane 3). The two arrows indicate the different migrations of EF-Tu in complex with GE2270A or with NAI003. (C) Inhibition by GE2270A (●) or NAI003 (■) in a protein synthesis system based on an E. coli extract programmed with 027-IF2Cp(A) mRNA.

Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic: Substitution b Domain c NAI003 GE2270A Compound 2 ATCC 6922 0.015 0.007 ≤0.06 L1015R13 C207A H68Q I 8 0.015 0.5 L1015R51 T245C V81A I 32 ≤0.06 1 L1015R6 G300T Q99H I 8 0.015 1 L1015R5 G300T Q99H I 2 0.007 0.5 L1015R7 G300T Q99H I 1 0.003 0.25 L1015R24 G781C G260R II >128 0.125 0.25 L1015R8 G781T G260C II 32 0.125 2 L1015R96 T791C M263T II 4 ≤0.06 4 L1015R73 A830G N276S II 1 0.007 0.125 L1015R72 A830G N276S II 2 0.007 0.25 L1015R21 C831G N276K II 1 0.03 0.25 L1015R86 None None 128 0.25 4 Open in a separate window a Nucleotide numbering is based on tuf sequence from P. acnes KPA171202 ( 15 ). b Amino acid numbering is based on EF-Tu sequence from P. acnes KPA171202 ( 15 ). c As defined by Parmeggiani et al. ( 11 ).

Techniques: In Vitro, Migration, Inhibition

Effect of GE2270A and NAI003 on the electrophoretic mobilities of different EF-Tus. Migration on native polyacrylamide gels of EF-Tu from E. coli (A), S. aureus (B), P. acnes (C), and S. pyogenes (D) in the presence of increasing concentrations (1, 4, 19, 50, and 100 μM, respectively) of GE2270A (lanes 2 to 6) or of NAI003 (lanes 7 to 11).

Journal: Antimicrobial Agents and Chemotherapy

Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes

doi: 10.1128/AAC.05155-14

Figure Lengend Snippet: Effect of GE2270A and NAI003 on the electrophoretic mobilities of different EF-Tus. Migration on native polyacrylamide gels of EF-Tu from E. coli (A), S. aureus (B), P. acnes (C), and S. pyogenes (D) in the presence of increasing concentrations (1, 4, 19, 50, and 100 μM, respectively) of GE2270A (lanes 2 to 6) or of NAI003 (lanes 7 to 11).

Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic: Substitution b Domain c NAI003 GE2270A Compound 2 ATCC 6922 0.015 0.007 ≤0.06 L1015R13 C207A H68Q I 8 0.015 0.5 L1015R51 T245C V81A I 32 ≤0.06 1 L1015R6 G300T Q99H I 8 0.015 1 L1015R5 G300T Q99H I 2 0.007 0.5 L1015R7 G300T Q99H I 1 0.003 0.25 L1015R24 G781C G260R II >128 0.125 0.25 L1015R8 G781T G260C II 32 0.125 2 L1015R96 T791C M263T II 4 ≤0.06 4 L1015R73 A830G N276S II 1 0.007 0.125 L1015R72 A830G N276S II 2 0.007 0.25 L1015R21 C831G N276K II 1 0.03 0.25 L1015R86 None None 128 0.25 4 Open in a separate window a Nucleotide numbering is based on tuf sequence from P. acnes KPA171202 ( 15 ). b Amino acid numbering is based on EF-Tu sequence from P. acnes KPA171202 ( 15 ). c As defined by Parmeggiani et al. ( 11 ).

Techniques: Migration

Effects of GE2270A and NAI003 on in vitro protein synthesis. (A) Poly(U)-dependent incorporation of [3H]Phe in a hot-trichloroacetic acid-insoluble product in the presence of increasing concentrations of different EF-Tus. The amounts of Phe incorporated with E. coli EF-Tu are indicated on the right ordinate, while those obtained with EF-Tu from P. acnes, S. aureus, E. faecalis, or S. pyogenes are indicated on the left ordinate. (B and C) Effects of GE2270A (B) and NAI003 (C) on in vitro translation with different EF-Tus. Symbols for EF-Tu are as follows: black circles, E. coli; red diamonds, P. acnes; purple squares, E. faecalis; green inverted triangles, S. aureus; turquoise triangles, S. pyogenes.

Journal: Antimicrobial Agents and Chemotherapy

Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes

doi: 10.1128/AAC.05155-14

Figure Lengend Snippet: Effects of GE2270A and NAI003 on in vitro protein synthesis. (A) Poly(U)-dependent incorporation of [3H]Phe in a hot-trichloroacetic acid-insoluble product in the presence of increasing concentrations of different EF-Tus. The amounts of Phe incorporated with E. coli EF-Tu are indicated on the right ordinate, while those obtained with EF-Tu from P. acnes, S. aureus, E. faecalis, or S. pyogenes are indicated on the left ordinate. (B and C) Effects of GE2270A (B) and NAI003 (C) on in vitro translation with different EF-Tus. Symbols for EF-Tu are as follows: black circles, E. coli; red diamonds, P. acnes; purple squares, E. faecalis; green inverted triangles, S. aureus; turquoise triangles, S. pyogenes.

Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic: Substitution b Domain c NAI003 GE2270A Compound 2 ATCC 6922 0.015 0.007 ≤0.06 L1015R13 C207A H68Q I 8 0.015 0.5 L1015R51 T245C V81A I 32 ≤0.06 1 L1015R6 G300T Q99H I 8 0.015 1 L1015R5 G300T Q99H I 2 0.007 0.5 L1015R7 G300T Q99H I 1 0.003 0.25 L1015R24 G781C G260R II >128 0.125 0.25 L1015R8 G781T G260C II 32 0.125 2 L1015R96 T791C M263T II 4 ≤0.06 4 L1015R73 A830G N276S II 1 0.007 0.125 L1015R72 A830G N276S II 2 0.007 0.25 L1015R21 C831G N276K II 1 0.03 0.25 L1015R86 None None 128 0.25 4 Open in a separate window a Nucleotide numbering is based on tuf sequence from P. acnes KPA171202 ( 15 ). b Amino acid numbering is based on EF-Tu sequence from P. acnes KPA171202 ( 15 ). c As defined by Parmeggiani et al. ( 11 ).

Techniques: In Vitro

Genotypes and phenotypes of P. acnes  NAI003  r mutants

Journal: Antimicrobial Agents and Chemotherapy

Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes

doi: 10.1128/AAC.05155-14

Figure Lengend Snippet: Genotypes and phenotypes of P. acnes NAI003 r mutants

Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic: Substitution b Domain c NAI003 GE2270A Compound 2 ATCC 6922 0.015 0.007 ≤0.06 L1015R13 C207A H68Q I 8 0.015 0.5 L1015R51 T245C V81A I 32 ≤0.06 1 L1015R6 G300T Q99H I 8 0.015 1 L1015R5 G300T Q99H I 2 0.007 0.5 L1015R7 G300T Q99H I 1 0.003 0.25 L1015R24 G781C G260R II >128 0.125 0.25 L1015R8 G781T G260C II 32 0.125 2 L1015R96 T791C M263T II 4 ≤0.06 4 L1015R73 A830G N276S II 1 0.007 0.125 L1015R72 A830G N276S II 2 0.007 0.25 L1015R21 C831G N276K II 1 0.03 0.25 L1015R86 None None 128 0.25 4 Open in a separate window a Nucleotide numbering is based on tuf sequence from P. acnes KPA171202 ( 15 ). b Amino acid numbering is based on EF-Tu sequence from P. acnes KPA171202 ( 15 ). c As defined by Parmeggiani et al. ( 11 ).

Techniques: Mutagenesis

Antimicrobial activity of purified corynaridin against pathogenic corynebacteria. The RPC fraction was used undiluted and in a dilution series against (a) C. glutamicum ATCC 13032, (b) C. striatum DSM 20668, and (c) C. amycolatum DSM 6922. For each spot, a 10-μL sample was used (RPC fraction with 606 μg/mL total protein). A nisin standard (250 μg/mL) and HPLC-grade H 2 O (control) were used as positive and negative controls, respectively.

Journal: Microbiology Spectrum

Article Title: Identification and Characterization of Corynaridin, a Novel Linaridin from Corynebacterium lactis

doi: 10.1128/spectrum.01756-22

Figure Lengend Snippet: Antimicrobial activity of purified corynaridin against pathogenic corynebacteria. The RPC fraction was used undiluted and in a dilution series against (a) C. glutamicum ATCC 13032, (b) C. striatum DSM 20668, and (c) C. amycolatum DSM 6922. For each spot, a 10-μL sample was used (RPC fraction with 606 μg/mL total protein). A nisin standard (250 μg/mL) and HPLC-grade H 2 O (control) were used as positive and negative controls, respectively.

Article Snippet: Corynebacterium amycolatum , DSM 6922 , DSMZ.

Techniques: Activity Assay, Purification, Control

Bacterial strains and plasmids used in this study

Journal: Microbiology Spectrum

Article Title: Identification and Characterization of Corynaridin, a Novel Linaridin from Corynebacterium lactis

doi: 10.1128/spectrum.01756-22

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: Corynebacterium amycolatum , DSM 6922 , DSMZ.

Techniques: Plasmid Preparation, Control