|
ATCC
substitution b domain c nai003 ge2270a compound 2 atcc ![]() Substitution B Domain C Nai003 Ge2270a Compound 2 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/substitution b domain c nai003 ge2270a compound 2 atcc/product/ATCC Average 93 stars, based on 1 article reviews
substitution b domain c nai003 ge2270a compound 2 atcc - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
ATCC
escherichia coli ![]() Escherichia Coli, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/escherichia coli/product/ATCC Average 93 stars, based on 1 article reviews
escherichia coli - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti aconitase 2 ![]() Anti Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti aconitase 2/product/Cell Signaling Technology Inc Average 93 stars, based on 1 article reviews
anti aconitase 2 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
DSMZ
corynebacterium amycolatum ![]() Corynebacterium Amycolatum, supplied by DSMZ, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/corynebacterium amycolatum/product/DSMZ Average 91 stars, based on 1 article reviews
corynebacterium amycolatum - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
|
Goldschmidt Chemical Corp
tegopren® 5842 ![]() Tegopren® 5842, supplied by Goldschmidt Chemical Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tegopren® 5842/product/Goldschmidt Chemical Corp Average 90 stars, based on 1 article reviews
tegopren® 5842 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Philips Healthcare
vacuum tube philips 6922 ![]() Vacuum Tube Philips 6922, supplied by Philips Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vacuum tube philips 6922/product/Philips Healthcare Average 90 stars, based on 1 article reviews
vacuum tube philips 6922 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Quikrete Companies
quik-tube part number 6922 ![]() Quik Tube Part Number 6922, supplied by Quikrete Companies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/quik-tube part number 6922/product/Quikrete Companies Average 90 stars, based on 1 article reviews
quik-tube part number 6922 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
DeGussa Corporation
tegopren 6922 ![]() Tegopren 6922, supplied by DeGussa Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tegopren 6922/product/DeGussa Corporation Average 90 stars, based on 1 article reviews
tegopren 6922 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
strong MicroRNA mmu miR 6922 3p strong Accession Number MIMAT0027745 Mature Sequence UGUUCUGCUCACCCUUCUCACAG mmu miR 6922 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
|
Buy from Supplier |
|
Hairpin precursor miRNA of approximately 150 nucleotides is cloned into lentiviral or non-viral vectors for delivery in virtually all cell types.
|
Buy from Supplier |
|
strong MicroRNA mmu miR 6922 5p strong Accession Number MIMAT0027744 Mature Sequence UGUGGGAGGGGACUGUAGAGAGG mmu miR 6922 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
|
Buy from Supplier |
Image Search Results
Journal: Antimicrobial Agents and Chemotherapy
Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes
doi: 10.1128/AAC.05155-14
Figure Lengend Snippet: Synthetic route to NAI003. DPPA, diphenyl phosphorazidate.
Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic:
Techniques:
Journal: Antimicrobial Agents and Chemotherapy
Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes
doi: 10.1128/AAC.05155-14
Figure Lengend Snippet: MICs of GE2270A, compound 2, and NAI003 against selected Gram-positive bacteria
Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic:
Techniques:
Journal: Antimicrobial Agents and Chemotherapy
Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes
doi: 10.1128/AAC.05155-14
Figure Lengend Snippet: MICs of GE2270A, compound 2, and NAI003 against P. acnes
Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic:
Techniques:
Journal: Antimicrobial Agents and Chemotherapy
Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes
doi: 10.1128/AAC.05155-14
Figure Lengend Snippet: Killing kinetics of P. acnes. Effect of NAI003 (closed symbols, solid lines) and clindamycin (empty symbols, dashed lines) on the viability of P. acnes, using the clindamycin-sensitive ND062711 (A) and clindamycin-resistant ND06311 (B) isolates. Compounds were added at 1× MIC (triangles), 10× MIC (circles), or 100× MIC (squares). In panel B, clindamycin was used at only 1× (open triangles) and 4× (open diamonds) the MIC. Growth controls are shown for both panels by a thick dashed line.
Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic:
Techniques:
Journal: Antimicrobial Agents and Chemotherapy
Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes
doi: 10.1128/AAC.05155-14
Figure Lengend Snippet: Effects of GE2270A and NAI003 on the electrophoretic mobility of EF-Tu and on in vitro translation. (A) Migration on native polyacrylamide gel of E. coli EF-Tu (preincubated with GTP) in the presence of increasing concentrations (from left to right, 0.1, 0.5, 1, 5, 10, 50, and 100 μM) of GE2270A (lanes 2 to 8) or NAI003 (lanes 9 to 15). (B) Electrophoretic mobility difference between EF-Tu–GTP alone (lane 1) and in the presence of 1 μM GE2270A (lane 2) or of 10 μM NAI003 (lane 3). The two arrows indicate the different migrations of EF-Tu in complex with GE2270A or with NAI003. (C) Inhibition by GE2270A (●) or NAI003 (■) in a protein synthesis system based on an E. coli extract programmed with 027-IF2Cp(A) mRNA.
Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic:
Techniques: In Vitro, Migration, Inhibition
Journal: Antimicrobial Agents and Chemotherapy
Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes
doi: 10.1128/AAC.05155-14
Figure Lengend Snippet: Effect of GE2270A and NAI003 on the electrophoretic mobilities of different EF-Tus. Migration on native polyacrylamide gels of EF-Tu from E. coli (A), S. aureus (B), P. acnes (C), and S. pyogenes (D) in the presence of increasing concentrations (1, 4, 19, 50, and 100 μM, respectively) of GE2270A (lanes 2 to 6) or of NAI003 (lanes 7 to 11).
Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic:
Techniques: Migration
Journal: Antimicrobial Agents and Chemotherapy
Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes
doi: 10.1128/AAC.05155-14
Figure Lengend Snippet: Effects of GE2270A and NAI003 on in vitro protein synthesis. (A) Poly(U)-dependent incorporation of [3H]Phe in a hot-trichloroacetic acid-insoluble product in the presence of increasing concentrations of different EF-Tus. The amounts of Phe incorporated with E. coli EF-Tu are indicated on the right ordinate, while those obtained with EF-Tu from P. acnes, S. aureus, E. faecalis, or S. pyogenes are indicated on the left ordinate. (B and C) Effects of GE2270A (B) and NAI003 (C) on in vitro translation with different EF-Tus. Symbols for EF-Tu are as follows: black circles, E. coli; red diamonds, P. acnes; purple squares, E. faecalis; green inverted triangles, S. aureus; turquoise triangles, S. pyogenes.
Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic:
Techniques: In Vitro
Journal: Antimicrobial Agents and Chemotherapy
Article Title: A Derivative of the Thiopeptide GE2270A Highly Selective against Propionibacterium acnes
doi: 10.1128/AAC.05155-14
Figure Lengend Snippet: Genotypes and phenotypes of P. acnes NAI003 r mutants
Article Snippet: When transposed to the crystal structure of T. thermophilus EF-Tu, the other observed mutations ( ) map to domain I (H68Q and V81A) or II (M263T), although they do not appear to be directly involved in antibiotic binding. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain tuf mutation a EF-Tu MIC (μg/ml) of antibiotic:
Techniques: Mutagenesis
Journal: Microbiology Spectrum
Article Title: Identification and Characterization of Corynaridin, a Novel Linaridin from Corynebacterium lactis
doi: 10.1128/spectrum.01756-22
Figure Lengend Snippet: Antimicrobial activity of purified corynaridin against pathogenic corynebacteria. The RPC fraction was used undiluted and in a dilution series against (a) C. glutamicum ATCC 13032, (b) C. striatum DSM 20668, and (c) C. amycolatum DSM 6922. For each spot, a 10-μL sample was used (RPC fraction with 606 μg/mL total protein). A nisin standard (250 μg/mL) and HPLC-grade H 2 O (control) were used as positive and negative controls, respectively.
Article Snippet:
Techniques: Activity Assay, Purification, Control
Journal: Microbiology Spectrum
Article Title: Identification and Characterization of Corynaridin, a Novel Linaridin from Corynebacterium lactis
doi: 10.1128/spectrum.01756-22
Figure Lengend Snippet: Bacterial strains and plasmids used in this study
Article Snippet:
Techniques: Plasmid Preparation, Control